The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

نویسندگان

  • F Takaiwa
  • M Kusuda
  • N Saga
  • M Sugiura
چکیده

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

The nucleotide sequences of 5S rRNAs from two red algae, Gracilaria compressa and Porphyra tenera.

The nucleotide sequences of 5S rRNA from two red algae, Gracilaria compressa and Porphyra tenera have been determined. The two 5S rRNAs are fairly dissimilar to each other in their sequences (65% identity), although they are both composed of 121 nucleotides. Their secondary structures are generally of the eukaryotic with a prokaryotic characteristic. Judged from the 5S rRNA sequence data, the r...

متن کامل

Generation of 10,154 expressed sequence tags from a leafy gametophyte of a marine red alga, Porphyra yezoensis.

A total of 10,154 5'-end expressed sequence tags (EST) were established from the normalized and size-selected cDNA libraries of a marine red alga, Porphyra yezoensis. Among the ESTs, 2140 were unique species, and the remaining 8014 were grouped into 1127 species. Database search of the 3267 non-redundant ESTs by BLAST algorithm showed that the sequences of 1080 species (33.1%) have similarity t...

متن کامل

Structural features of a gene encoding the vacuolar H+-ATPase c subunit from a marine red alga, Porphyra yezoensis.

We report the nucleotide sequence of a gene encoding the c ('16 kDa') subunit of the vacuolar-type H+-ATPase (V-ATPase) from a marine red alga, Porphyra yezoensis. A cDNA clone was isolated from a leafy gametophyte cDNA library and analyzed for the sequence. The genomic DNA sequence was directly determined by nested PCR. The structural gene contained four introns within a coding sequence of 483...

متن کامل

Characterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.

Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3...

متن کامل

Identification of miRNA from Porphyra yezoensis by High-Throughput Sequencing and Bioinformatics Analysis

BACKGROUND miRNAs are a class of non-coding, small RNAs that are approximately 22 nucleotides long and play important roles in the translational level regulation of gene expression by either directly binding or cleaving target mRNAs. The red alga, Porphyra yezoensis is one of the most important marine economic crops worldwide. To date, only a few miRNAs have been identified in green unicellar a...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Nucleic acids research

دوره 10 19  شماره 

صفحات  -

تاریخ انتشار 1982